Sequence ID | >WENV181024862 |
Genome ID | ODWX01241156 |
Search identical group | |
Phylum/Class | [ODWX] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 83 |
End posion on genome | 157 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cggtccataT |
tRNA gene sequence |
GCCATGGTAGTTCAGTTGGGAGAACGCCAGACTGAAGATCTGGATGTCGCTGGTTCAAGT |
Downstream region at tRNA end position |
actattttta |
Secondary structure (Cloverleaf model) | >WENV181024862 Phe GAA T ATta actattttta G - C C - G C - G A - T T - A G - C G - C T G T C G G C C A T G A A | | + | | A T C T T G G C T G G C G | | | | T T G G A A C G A G ATGTC C - G C - G A - T G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |