Sequence ID | >WENV181026313 |
Genome ID | ODXC01000569 |
Search identical group | |
Phylum/Class | [ODXC] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 2901 |
End posion on genome | 2974 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cacacagaat |
tRNA gene sequence |
GATTCGCTAGCTCAGCAGGTAGAGCACATCCCTTTTAAGGATGGGGTCCTGGGTTCGACC |
Downstream region at tRNA end position |
aaaacaaaag |
Secondary structure (Cloverleaf model) | >WENV181026313 Lys TTT t ACgg aaaacaaaag G - C A - T T - A T + G C - G G - C C - G C C T G A C C C A C G A A | | | | | G A C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |