Sequence ID | >WENV181030218 |
Genome ID | ODXF01085165 |
Search identical group | |
Phylum/Class | [ODXF] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 108 |
End posion on genome | 32 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cttaaaggat |
tRNA gene sequence |
GACCCCGTAGCTCAATTGGATAGAGTGACTCCCTCCTAAGGAGTAGGTTGTGTGTTCAAG |
Downstream region at tRNA end position |
tttttagtta |
Secondary structure (Cloverleaf model) | >WENV181030218 Arg CCT t GCCA tttttagtta G - C A - T C - G C - G C - G C - G G - C C G T T A C A C A T A A A + | | | | A T C T C G G T G T G C G | | | + T T G G A G T A T A G AGGTT A - T C - G T - A C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |