Sequence ID | >WENV181034612 |
Genome ID | ODXO01000666 |
Search identical group | |
Phylum/Class | [ODXO] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 344 |
End posion on genome | 258 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aaaacaactt |
tRNA gene sequence |
GGAGAGATATCGAAGCGGTCATAACGAGGCGGTCTTGAAAACCGTTTGTCCGAAAGGGCG |
Downstream region at tRNA end position |
actttcatac |
Secondary structure (Cloverleaf model) | >WENV181034612 Ser TGA t GCtg actttcatac G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A G C G A A | | | | | G G A G C T G A G G G C T | | | T T C A C G A A T A G TTGTCCGAAAGGGCGC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |