Sequence ID | >WENV181042974 |
Genome ID | ODXU01022356 |
Search identical group | |
Phylum/Class | [ODXU] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 118 |
End posion on genome | 29 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aatattttta |
tRNA gene sequence |
CGGGAGATGGCTGAGCGGTCGAAAGCGGCGGTCTTGAAAACCGTTGAGGTGTGAAAGCCT |
Downstream region at tRNA end position |
ttatctaaat |
Secondary structure (Cloverleaf model) | >WENV181042974 Ser TGA a GCCA ttatctaaat C - G G - C G - C G - C A - T G - C A - T T A T A T C C C A C G A G | + | | | G G G T C G T G G G G C G | | | T T T A A G C C G A G TGAGGTGTGAAAGCCTCC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |