Sequence ID | >WENV181043045 |
Genome ID | ODXU01032417 |
Search identical group | |
Phylum/Class | [ODXU] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 84 |
End posion on genome | 158 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttgatgttct |
tRNA gene sequence |
GGCGGTGTAGCTCAGCTGGTTAGAGCGCACGACTCATAATCGTGAGGTCGACGGATCGAG |
Downstream region at tRNA end position |
cccgatagct |
Secondary structure (Cloverleaf model) | >WENV181043045 Met CAT t ACgc cccgatagct G + T G - C C - G G - C G - C T - A G - C C G T C T G C C A C G A A | | | | | G T C T C G G A C G G C G | | | | A T G G A G C T T A G AGGTC C - G A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |