Sequence ID | >WENV181043335 |
Genome ID | ODXU01131805 |
Search identical group | |
Phylum/Class | [ODXU] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 109 |
End posion on genome | 34 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tcgagtcctt |
tRNA gene sequence |
GGGGCTATGGCGCAGTTGGTAGCGCGTCTCGTTCGCAATGAGAAGGTCGGGGGTTCGAAT |
Downstream region at tRNA end position |
cctcgaaagg |
Secondary structure (Cloverleaf model) | >WENV181043335 Ala CGC t ACCA cctcgaaagg G - C G - C G + T G - C C - G T - A A - T T A T C C C C C A T G A G | | | | | G T C G C G G G G G G C G | | | | T T G G C G C T A G AGGTC T - A C - G T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |