Sequence ID | >WENV181045488 |
Genome ID | ODXW01000303 |
Search identical group | |
Phylum/Class | [ODXW] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 4103 |
End posion on genome | 4177 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cgaaagtcaa |
tRNA gene sequence |
GGCCTCGTGGCGCAGTTGGTTAGCGCGTCGCCCTGTCACGGCGAAGGTCGCGGGTTCAAG |
Downstream region at tRNA end position |
aaaagttggc |
Secondary structure (Cloverleaf model) | >WENV181045488 Asp GTC a GCga aaaagttggc G - C G + T C - G C - G T - A C - G G - C T G T T G C C C A T G A G + | | | | A T C G C G G C G G G C G | | | | T T G G C G C T T A G AGGTC T - A C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |