Sequence ID | >WENV181049326 |
Genome ID | ODYD01000032 |
Search identical group | |
Phylum/Class | [ODYD] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 59108 |
End posion on genome | 59182 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tacctgcaag |
tRNA gene sequence |
GGGAACGTCGTATAGTGGCTAATACCTCAGCCTTCCAAGCTGAAGACGCGGGTTCGATTC |
Downstream region at tRNA end position |
aggatcgcct |
Secondary structure (Cloverleaf model) | >WENV181049326 Gly TCC g TCCA aggatcgcct G - C G - C G - C A - T A - T C - G G - C T T T T G C C C A T G A C + | | | | G G T A T G G C G G G C G | | | | T T C A T A C T A C AGAC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |