Sequence ID | >WENV181049917 |
Genome ID | ODYD01003328 |
Search identical group | |
Phylum/Class | [ODYD] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 2214 |
End posion on genome | 2130 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cagttgagac |
tRNA gene sequence |
GCGGGAGTGGCGGAATTGGCAGACGCACCAGACTTAGGATCTGGCGCCTTACGGCGTGGG |
Downstream region at tRNA end position |
actttattgc |
Secondary structure (Cloverleaf model) | >WENV181049917 Leu TAG c ACCA actttattgc G - C C - G G - C G - C G - C A - T G - C T G T T T C C C A T A A G + + | | | A T G G C G G G G G G C G | | | T T G A C G C C A G A CGCCTTACGGCGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |