Sequence ID | >WENV181050402 |
Genome ID | ODYD01017296 |
Search identical group | |
Phylum/Class | [ODYD] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 1396 |
End posion on genome | 1321 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
agggcgcatg |
tRNA gene sequence |
GTGGGTATAGCTCAGTTGGTAGAGCACCTGGTTGTGGTCCAGGATGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
gatggggtag |
Secondary structure (Cloverleaf model) | >WENV181050402 His GTG g CCCA gatggggtag G - C T - A G - C G + T G - C T - A A - T T A T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A ATGTC C - G C - G T - A G - C G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |