Sequence ID | >WENV181051592 |
Genome ID | ODYE01000389 |
Search identical group | |
Phylum/Class | [ODYE] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 6939 |
End posion on genome | 6865 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taaaaaattt |
tRNA gene sequence |
GCCCCGTTCGTTCAGTGGTTAGGACATCAGATTTTCACTCTGGAAACAGGGGTTCAATTC |
Downstream region at tRNA end position |
taacacggaa |
Secondary structure (Cloverleaf model) | >WENV181051592 Glu TTC t ACCA taacacggaa G + T C - G C - G C - G C - G G - C T - A T T T T C C C C A T G A C | | | | | A G C T T G A G G G G C G | + | | T T T G G A C T A A AAAC T + G C - G A - T G - C A - T T C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |