Sequence ID | >WENV181059460 |
Genome ID | ODYM01001261 |
Search identical group | |
Phylum/Class | [ODYM] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 7261 |
End posion on genome | 7348 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaatataaat |
tRNA gene sequence |
GCCTGGATGGCGGAATAGGTAGACGCACGGGACTTAAAATCCCGTGGTACTTAGTACCGT |
Downstream region at tRNA end position |
tttatattct |
Secondary structure (Cloverleaf model) | >WENV181059460 Leu TAA t ACCA tttatattct G - C C - G C - G T - A G + T G - C A - T T T T C G G C C A T A A G | | | | | G A G G C G G C C G G C G | | | T T G A C G C T A G A TGGTACTTAGTACCGT C - G G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |