Sequence ID | >WENV181062964 |
Genome ID | ODYP01000015 |
Search identical group | |
Phylum/Class | [ODYP] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 22651 |
End posion on genome | 22722 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
aaccactatt |
tRNA gene sequence |
GCCGATGTAGTTCAATGGCAGAACTCCTGCTTCCCAAGCAGGCGGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
taatagaaac |
Secondary structure (Cloverleaf model) | >WENV181062964 Gly CCC t TCtt taatagaaac G - C C - G C - G G - C A - T T - A G - C T T T T G C C C A A A A + | | | | G T C T T G G C G G G C G | | | | T T G G A A C C A T CGGC C - G C - G T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |