Sequence ID | >WENV181066039 |
Genome ID | ODYV01031599 |
Search identical group | |
Phylum/Class | [ODYV] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 284 |
End posion on genome | 360 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
atggttgtat |
tRNA gene sequence |
GCCTCGGTAGCTCAACTGGATAGAGCAGATCCGTCCTAAGGATAAGGTTGTAGGTTCGAC |
Downstream region at tRNA end position |
tagactatga |
Secondary structure (Cloverleaf model) | >WENV181066039 Arg CCT t ACCA tagactatga G + T C - G C - G T + G C - G G - C G - C T C T C G T C C A C A A A | + | | | G T C T C G G T A G G C G | | | | T T G G A G C A T A A AGGTT G A A - T T - A C - G C - G G A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |