| Sequence ID | >WENV181068884 |
| Genome ID | ODZZ01004349 |
| Phylum/Class | [ODZZ] human metagenome; G_DNA_Tongue dorsum |
| Species | |
| Start position on genome | 4074 |
| End posion on genome | 3999 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
tttgaattta |
| tRNA gene sequence |
GGGGGCTTAGCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGTCAGCGGTTCGATC |
| Downstream region at tRNA end position |
taaaatagtt |
| Secondary structure (Cloverleaf model) | >WENV181068884 Ala TGC
a ACCA taaaatagtt
G - C
G - C
G + T
G - C
G + T
C T
T - A C T
T T C G C C A
C G A A | | | | | G
T C T C G A G C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
C - G
T - A
G - C
C - G
T C
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |