Sequence ID | >W141105301 |
Genome ID | AVON01000004 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus VP-NY4 [AVON] |
Start position on genome | 199956 |
End posion on genome | 200032 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cgaaaactgc |
tRNA gene sequence |
GCGTCCTTAGCTCAGCTGGATAGAGTACCTGGCTACGAACCAGGCGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
ctttttaggg |
Secondary structure (Cloverleaf model) | >W141105301 Arg ACG c GCCA ctttttaggg G - C C - G G - C T - A C - G C - G T - A T A T C C T C C A C G A A | | | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A CGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |