Sequence ID | >WENV181076053 |
Genome ID | OEAP01001505 |
Search identical group | |
Phylum/Class | [OEAP] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 3699 |
End posion on genome | 3774 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ggctctccgg |
tRNA gene sequence |
GCCCCAGTAGCTCAGTGGATAGAGCAACAGCCTTCTAATCTGTCGTGCGCAGGTTCGAGT |
Downstream region at tRNA end position |
agtaccctgt |
Secondary structure (Cloverleaf model) | >WENV181076053 Arg TCT g GCCA agtaccctgt G - C C - G C - G C - G C - G A - T G - C T G T C G T C C A T G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A A CGTGC A - T C - G A - T G - C C T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |