Sequence ID | >WENV181076337 |
Genome ID | OEAP01003981 |
Search identical group | |
Phylum/Class | [OEAP] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 4711 |
End posion on genome | 4628 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
catccccgac |
tRNA gene sequence |
GCGCGAGTGGCGGAATGGTAGACGCGCTGGCTTCAGGTGCCAGTGCCCGCAAGGGCGTGG |
Downstream region at tRNA end position |
tgaaggtcct |
Secondary structure (Cloverleaf model) | >WENV181076337 Leu CAG c ACgg tgaaggtcct G - C C - G G - C C - G G - C A - T G - C T C T T C T C C A T A A G + | | | | A G G G C G G G A G G C G | | | T T T A C G C A G G TGCCCGCAAGGGCGT C - G T - A G - C G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |