Sequence ID | >WENV181077893 |
Genome ID | OEAP01215542 |
Search identical group | |
Phylum/Class | [OEAP] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 131 |
End posion on genome | 56 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tttaaattga |
tRNA gene sequence |
GGTCACGTAGCTCAGTTGGATAGAGCATCTGCCTTCTAAGCAGACGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
tcggggtgta |
Secondary structure (Cloverleaf model) | >WENV181077893 Arg TCT a ACCt tcggggtgta G - C G + T T - A C - G A - T C - G G - C T A T T G T C C A T G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A CGGTC T - A C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |