Sequence ID | >WENV181083522 |
Genome ID | OEAV01009943 |
Search identical group | |
Phylum/Class | [OEAV] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 2579 |
End posion on genome | 2505 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gccgtacacg |
tRNA gene sequence |
GTGGCTGTAGCTCAGTCGGCAGAGCGCCTGGTTGTGGTCCAGGAGGTCGCGGGTTCAAAC |
Downstream region at tRNA end position |
ctcctcggtt |
Secondary structure (Cloverleaf model) | >WENV181083522 His GTG g CCCg ctcctcggtt G - C T - A G - C G - C C - G T - A G - C C A T T G C C C A T G A A + | | | | A C C T C G G C G G G C G | | | | T T G G A G C C A G AGGTC C - G C - G T - A G - C G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |