Sequence ID | >WENV181090228 |
Genome ID | OEBC01000031 |
Search identical group | |
Phylum/Class | [OEBC] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 689 |
End posion on genome | 601 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cacatcctaa |
tRNA gene sequence |
GCCCGGGTGGCGGAATGGCAGACGCGCTAGCTTGAGGTGCTAGTGTCCTACTAATGGACG |
Downstream region at tRNA end position |
cagcatcgct |
Secondary structure (Cloverleaf model) | >WENV181090228 Leu GAG a ACCA cagcatcgct G - C C - G C - G C - G G - C G + T G - C T G T C C C C C A T A A G | | | | | A G G G C G G G G G G C G | | | T T C A C G C A G G TGTCCTACTAATGGACGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |