Sequence ID | >WENV181090512 |
Genome ID | OEBC01000867 |
Search identical group | |
Phylum/Class | [OEBC] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 2552 |
End posion on genome | 2628 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
aactgaactt |
tRNA gene sequence |
TGGGGATTCGCCAAGTTGGTTAAGGCACCGGATTCTGAATCCGGCATGCGTAGGTTCGAG |
Downstream region at tRNA end position |
aataaaagcg |
Secondary structure (Cloverleaf model) | >WENV181090512 Gln CTG t GCCA aataaaagcg T - A G - C G - C G - C G - C A - T T - A T G T C A T C C A T G A C | | | | | G T A C C G G T A G G C G | | | T T G A G G C T T A A CATGC C - G C - G G - C G - C A - T T A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |