Sequence ID | >WENV181101795 |
Genome ID | OECT01000260 |
Search identical group | |
Phylum/Class | [OECT] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 7169 |
End posion on genome | 7095 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aactaaatac |
tRNA gene sequence |
GGGGCTATGGCGCAGTTGGTAGCGCGCTTCCATGGCATGGAAGAGGTCGGGGGTTCGAAT |
Downstream region at tRNA end position |
aaaatccggt |
Secondary structure (Cloverleaf model) | >WENV181101795 Ala GGC c ACCg aaaatccggt G - C G - C G + T G - C C - G T - A A - T T A T C C C C C A T G A G | | | | | G T C G C G G G G G G C G | | | | T T G G C G C T A G AGGTC C - G T - A T - A C - G C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |