Sequence ID | >WENV181102213 |
Genome ID | OECT01001278 |
Search identical group | |
Phylum/Class | [OECT] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 15487 |
End posion on genome | 15571 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
atgcacttat |
tRNA gene sequence |
GGAGAGGTGGCGGAATTGGTAGACGCGCTACTTTGAGGGGGTAGTGAAAATTGCTTCGTG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV181102213 Leu GAG t ACtn nnnnnnnnnn G - C G + T A - T G - C A - T G - C G - C T G T T C C T C A T A A G + | | | | G T G G C G G G G A G C G | | | T T G A C G C T A G G TGAAAATTGCTTCGT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |