Sequence ID | >WENV181105299 |
Genome ID | OEED01002531 |
Search identical group | |
Phylum/Class | [OEED] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 684 |
End posion on genome | 611 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttatcaactt |
tRNA gene sequence |
TCCCCTGTAGCTCAGTAGGCAGAGCAAGTGGCTGTTAACCACTGGGTCCGTGGTTCGAAC |
Downstream region at tRNA end position |
tcaaagctca |
Secondary structure (Cloverleaf model) | >WENV181105299 Asn GTT t GCtt tcaaagctca T - A C - G C - G C - G C - G T + G G - C C A T G C G C C A T G A A | | + | | G A C T C G C G T G G C G | | | | T T G G A G C C A A GGGTC A - T G - C T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |