Sequence ID | >WENV181105820 |
Genome ID | OEED01018794 |
Search identical group | |
Phylum/Class | [OEED] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 1295 |
End posion on genome | 1222 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
agcaatcact |
tRNA gene sequence |
GCGGGCGTAGTTCATCGGTAGAATGAAAGCTTCCCAAGCTTTAGAGGTGGGTTCGACTCC |
Downstream region at tRNA end position |
gagaaaatac |
Secondary structure (Cloverleaf model) | >WENV181105820 Gly CCC t TCCA gagaaaatac G - C C - G G - C G - C G - C C - G G - C T C T T A C C C A T A A + | | | | G C C T T G G T G G G C G | | | + T T G G A A T T A G AGAG A - T A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |