Sequence ID | >WENV181107320 |
Genome ID | OEEI01004941 |
Search identical group | |
Phylum/Class | [OEEI] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 694 |
End posion on genome | 779 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
actttgtcac |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGCAGACGCGCTACTTTGAGGGGGTAGTGTTCACAAGACGTGT |
Downstream region at tRNA end position |
ttttttaggc |
Secondary structure (Cloverleaf model) | >WENV181107320 Leu GAG c ACCA ttttttaggc G - C C - G G - C G - C T - A C - G G - C T G T C A C C C A T A A G | | | | | A T G G C G G T G G G C G | | | T T G A C G C C A G G TGTTCACAAGACGT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |