Sequence ID | >WENV181108215 |
Genome ID | OEEI01140395 |
Search identical group | |
Phylum/Class | [OEEI] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 75 |
End posion on genome | 1 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tgcgggccgc |
tRNA gene sequence |
GGACCTGTAGCTCAGTTGGTAGAGCAATGCGTTTACACCGCATCGGTCGTCGGTTCGAGT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV181108215 Val TAC c ACCn nnnnnnnnnn G - C G - C A - T C - G C - G T + G G - C T G T C G G C C A T G A A | + | | | G T C T C G G T C G G C G | | | | T T G G A G C T A A CGGTC A - T T - A G - C C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |