Sequence ID | >WENV181112639 |
Genome ID | OEEL01001772 |
Search identical group | |
Phylum/Class | [OEEL] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 1627 |
End posion on genome | 1545 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cactcgttat |
tRNA gene sequence |
GCGCCTGTGGCGGAATTGGTAGACGCGCTAGACTTAGGATCTAGTAACTTACGTTGTGCA |
Downstream region at tRNA end position |
aaaagagcta |
Secondary structure (Cloverleaf model) | >WENV181112639 Leu TAG t ACaa aaaagagcta G - C C - G G - C C - G C - G T - A G + T T G T T G T C C A T A A G + | | | | G T G G C G G C A G G C G | | | T T G A C G C T A G G TAACTTACGTTGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |