Sequence ID | >WENV181113380 |
Genome ID | OEEL01023773 |
Search identical group | |
Phylum/Class | [OEEL] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 478 |
End posion on genome | 550 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
ttacatcact |
tRNA gene sequence |
GGCTGCATAGTTTAATGGATAGAACTACGGATTTCGGCTCCGTCGGTGAGGGTTCGAATC |
Downstream region at tRNA end position |
ataaccaatc |
Secondary structure (Cloverleaf model) | >WENV181113380 Arg TCG t ACaa ataaccaatc G - C G + T C - G T + G G - C C - G A - T T A T C T T C C A T A A A | | + | | G G T T T G G A G G G C G + | | | T T A G A A C T A T CGGT A - T C - G G - C G - C A - T T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |