Sequence ID | >WENV181113806 |
Genome ID | OEEL01129319 |
Search identical group | |
Phylum/Class | [OEEL] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 47 |
End posion on genome | 122 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ataataaatG |
tRNA gene sequence |
GTGGTTTTAGCTCAGTTGGTTAGAGCGTCGGATTGTGGTTCCGAAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
agggaaaccc |
Secondary structure (Cloverleaf model) | >WENV181113806 His GTG G CCaa agggaaaccc G - C T - A G - C G - C T T T T T - A C G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T T A G AGGTC T - A C - G G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |