Sequence ID | >WENV181120204 |
Genome ID | OEFJ01010433 |
Search identical group | |
Phylum/Class | [OEFJ] human metagenome; G_DNA_Attached/Keratinized gingiva |
Species | |
Start position on genome | 828 |
End posion on genome | 752 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cattttatac |
tRNA gene sequence |
GGCCCGGTAGTTTAGTTGGTTAGAATGCCGCCCTGTCACGGCGGAGGTCAGGGGTTCAAG |
Downstream region at tRNA end position |
tttttatgcc |
Secondary structure (Cloverleaf model) | >WENV181120204 Asp GTC c GCCA tttttatgcc G - C G + T C - G C - G C - G G - C G + T T G T T C C C C A T G A A | | | | | A T T T T G A G G G G C G + | | + T T G G A A T T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |