Sequence ID | >WENV181120238 |
Genome ID | OEFJ01013614 |
Search identical group | |
Phylum/Class | [OEFJ] human metagenome; G_DNA_Attached/Keratinized gingiva |
Species | |
Start position on genome | 152 |
End posion on genome | 77 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctcggcatgt |
tRNA gene sequence |
GCTGGAGTGGCGCAATCGGTAGCGCAACGGTCTTGTAAACCGTAGGTTGTGGGTTCAAGT |
Downstream region at tRNA end position |
ctgaagaaaa |
Secondary structure (Cloverleaf model) | >WENV181120238 Thr TGT t TCCA ctgaagaaaa G - C C - G T - A G - C G - C A - T G - C T G T T A C C C A T A A G + | | | | A C C G C G G T G G G C G | | | | T T G G C G C T A A AGGTT A - T C - G G - C G - C T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |