Sequence ID | >WENV181120540 |
Genome ID | OEFK01009492 |
Search identical group | |
Phylum/Class | [OEFK] marine metagenome; ENVO:00002010 seawater |
Species | |
Start position on genome | 149 |
End posion on genome | 225 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gggtgccagt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCGTCTGTTTTGGGTACAGAAGGTCGTGAGTTCGAT |
Downstream region at tRNA end position |
tttctcacaa |
Secondary structure (Cloverleaf model) | >WENV181120540 Pro TGG t ACCA tttctcacaa C - G G - C G - C G - C G - C C - G G - C T T T C G C T C A C G A A | + | | | G C C G C G G T G A G C T | | | | T T G G C G C G T A G AGGTC T - A C - G T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |