Sequence ID | >WENV181122879 |
Genome ID | OEFN01010706 |
Search identical group | |
Phylum/Class | [OEFN] human metagenome; G_DNA_Buccal mucosa |
Species | |
Start position on genome | 339 |
End posion on genome | 256 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttaataagcc |
tRNA gene sequence |
GGGAAGATAGCGAAGAGGCTAAACGCGGCGGACTGTAAATCCGCTCCTTCGGGTTCAGTG |
Downstream region at tRNA end position |
ttcttaatat |
Secondary structure (Cloverleaf model) | >WENV181122879 Tyr GTA c ACCA ttcttaatat G - C G - C G - C A - T A - T G - C A - T T A T T C A C C A A G A A | | | | | G G A G C G A G T G G C G | | | T T C A C G C T A A G TCCTTCGGGTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |