Sequence ID | >WENV181124156 |
Genome ID | OEFQ01016793 |
Search identical group | |
Phylum/Class | [OEFQ] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 646 |
End posion on genome | 575 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGGGATGTAGCTTAATGGTAAAGCCTCAGTCTTCCAAACTGATGACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
tatatataaa |
Secondary structure (Cloverleaf model) | >WENV181124156 Gly TCC n TCgg tatatataaa G - C G - C G - C G - C A - T T - A G - C T T T T G C C C A A A A + | | | | G T T T C G G C G G G C G | | | | T T G A A G C T A C TGAC T - A C - G A - T G - C T - A C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |