Sequence ID | >WENV181125621 |
Genome ID | OEFU01005746 |
Search identical group | |
Phylum/Class | [OEFU] human metagenome; G_DNA_Saliva |
Species | |
Start position on genome | 112 |
End posion on genome | 38 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
aactaactgt |
tRNA gene sequence |
GGGCCTATAGCTCAGGGGTAGAGCAACCGGCTCATAACCGGTCGGTCCCTGGTTCGAACC |
Downstream region at tRNA end position |
attatgttga |
Secondary structure (Cloverleaf model) | >WENV181125621 Ile2 CAT t ACCA attatgttga G - C G - C G - C C - G C - G T + G A - T C A T G G A C C A G A A | | | | | G G C T C G C C T G G C G | | | | T T G G A G C T A A CGGTC A - T C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |