Sequence ID | >WENV181125942 |
Genome ID | OEFU01127495 |
Search identical group | |
Phylum/Class | [OEFU] human metagenome; G_DNA_Saliva |
Species | |
Start position on genome | 164 |
End posion on genome | 89 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
taataaattt |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTCATCGCGCTTGGTTTGGGACCAAGAGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
aagtttatta |
Secondary structure (Cloverleaf model) | >WENV181125942 Pro TGG t ACaa aagtttatta C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C C G A A | | | | | G C T G C G G C A G G C G | | | T T G T C G C T C A G AGGTC C - G T - A T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |