Sequence ID | >WENV181131428 |
Genome ID | OEGC01000064 |
Search identical group | |
Phylum/Class | [OEGC] human metagenome; G_DNA_Anterior nares |
Species | |
Start position on genome | 21001 |
End posion on genome | 21088 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ccttatttac |
tRNA gene sequence |
GGTGACGTGTCTGAGCGGCCGAAAGTGCCCGCCTCGAAAGCGGGTGTAGCGAGAGCTACC |
Downstream region at tRNA end position |
gctgggtccc |
Secondary structure (Cloverleaf model) | >WENV181131428 Ser CGA c GCCA gctgggtccc G - C G - C T - A G - C A - T C - G G - C T A T C T C C C A C G A G | | | | | A G G T C T G A G G G C G | | T T C A A G T C G A G TGTAGCGAGAGCTACC C - G C - G C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |