Sequence ID | >WENV181132357 |
Genome ID | OEGE01001180 |
Search identical group | |
Phylum/Class | [OEGE] human metagenome; G_DNA_Stool |
Species | |
Start position on genome | 12914 |
End posion on genome | 12842 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tataatatac |
tRNA gene sequence |
GGTTCGTTGGTCAAGCGGTTAAGACGCCGCCCTCTCACGGCGGAAACACGGGTTCGATTC |
Downstream region at tRNA end position |
aaacaaaaag |
Secondary structure (Cloverleaf model) | >WENV181132357 Glu CTC c GCta aaacaaaaag G + T G - C T - A T + G C - G G - C T - A T T T T G C C C A C G A G | | | | | G G A C T G A C G G G C G | | | T T T A G A C T A G AAAC C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |