| Sequence ID | >WENV181135025 |
| Genome ID | OEGG01001874 |
| Phylum/Class | [OEGG] human metagenome; G_DNA_Tongue dorsum |
| Species | |
| Start position on genome | 3942 |
| End posion on genome | 3870 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
tcatccgctc |
| tRNA gene sequence |
GGGCGATTGGCGCAGTGGTAGCGCGCTTCCCTGACACGGAAGAGGTCACTGGTTCGAACC |
| Downstream region at tRNA end position |
tcgttatcta |
| Secondary structure (Cloverleaf model) | >WENV181135025 Val GAC
c ACtg tcgttatcta
G - C
G - C
G - C
C - G
G - C
A - T
T - A C A
T T G A C C A
G A G | | | | | G
T C G C G A C T G G C
G | | | | T T
G G C G C
T A G AGGTC
C - G
T - A
T - A
C - G
C - G
C C
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |