Sequence ID | >WENV181135443 |
Genome ID | OEGG01017538 |
Search identical group | |
Phylum/Class | [OEGG] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 407 |
End posion on genome | 317 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agtaaagcat |
tRNA gene sequence |
GGAGGATTACTCAAGAGGCTGAAGAGGACGGTTTGCTAAATCGTTAGGGCGGGTTACCGT |
Downstream region at tRNA end position |
tgctgagacc |
Secondary structure (Cloverleaf model) | >WENV181135443 Ser GCT t GCCA tgctgagacc G - C G - C A - T G - C G - C A - T T - A T A T A T C C C A A G A A | | | | | G G A C T C T A G G G C G | | | T T C A G A G T G A G TAGGGCGGGTTACCGTCGC A - T C - G G - C G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |