Sequence ID | >WENV181135560 |
Genome ID | OEGG01036683 |
Search identical group | |
Phylum/Class | [OEGG] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 90 |
End posion on genome | 165 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tttaatacat |
tRNA gene sequence |
GGGGGCGTAGCTCAGTTGGGAGAGCACCTGCCTTGCAAGCAGGGGGTCAGGAGTTCGAAT |
Downstream region at tRNA end position |
ttagtatcgt |
Secondary structure (Cloverleaf model) | >WENV181135560 Ala TGC t ACCA ttagtatcgt G - C G - C G + T G - C G + T C - G G - C T A T T C C T C A T G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |