| Sequence ID | >WENV181137147 |
| Genome ID | OEGJ01000464 |
| Phylum/Class | [OEGJ] human metagenome; G_DNA_Supragingival plaque |
| Species | |
| Start position on genome | 6681 |
| End posion on genome | 6755 |
| Amino Acid | Ile2 |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ctttaaattt |
| tRNA gene sequence |
GGGGCTATAGCTCAGTCGGTTAGAGCTGCGGACTCATAATCCGTCGGTCCCGGGTTCGAG |
| Downstream region at tRNA end position |
tcatacccca |
| Secondary structure (Cloverleaf model) | >WENV181137147 Ile2 CAT
t ACga tcatacccca
G - C
G - C
G - C
G - C
C - G
T + G
A - T C G
T G G C C C A
T G A A | | | | | G
C C T C G C C G G G C
G | | | | T T
G G A G C
T T A T CGGTC
G + T
C - G
G - C
G - C
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |