Sequence ID | >WENV181137374 |
Genome ID | OEGJ01002342 |
Search identical group | |
Phylum/Class | [OEGJ] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 2068 |
End posion on genome | 2140 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
taagaaagaa |
tRNA gene sequence |
GGTCTTGTAGTTCAACGGATAGAATAGAAGTTTCCTAAACTTTAGATCCAAGTTCGATTC |
Downstream region at tRNA end position |
taccttataa |
Secondary structure (Cloverleaf model) | >WENV181137374 Arg CCT a ACat taccttataa G - C G - C T - A C - G T - A T - A G - C T T T G G T T C A C A A A | | | | | G G C T T G C C A A G C G | | | + T T A G A A T T A A AGAT G + T A - T A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |