Sequence ID | >WENV181137768 |
Genome ID | OEGJ01023026 |
Search identical group | |
Phylum/Class | [OEGJ] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 1110 |
End posion on genome | 1034 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttacttgtat |
tRNA gene sequence |
GTCCTCATAGCTCAGCTGGATAGAGCGCAGAATTCCTAATTCTGAGGCCGTGAGTTCGAA |
Downstream region at tRNA end position |
tctgcctaaa |
Secondary structure (Cloverleaf model) | >WENV181137768 Arg CCT t ACCA tctgcctaaa G - C T - A C - G C - G T + G C - G A - T T A T C G C T C A C G A A | + | | | G T C T C G G T G A G C G | | | | T T G G A G C A T A G AGGCC C - G A - T G - C A - T A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |