Sequence ID | >WENV181141079 |
Genome ID | OEGT01001074 |
Search identical group | |
Phylum/Class | [OEGT] human metagenome; G_DNA_Throat |
Species | |
Start position on genome | 6599 |
End posion on genome | 6672 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttggccctgc |
tRNA gene sequence |
GCCCCAGTAGCTCAGTGGATAGAGCGTCTGCCTCCGGAGCAGAAGGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
tttgtgcgca |
Secondary structure (Cloverleaf model) | >WENV181141079 Arg CCG c ACtt tttgtgcgca G - C C - G C - G C - G C - G A - T G - C T A T T G T C C A T G A A + | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A G AGGTC T - A C - G T - A G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |