Sequence ID | >WENV181144112 |
Genome ID | OEHM01098726 |
Search identical group | |
Phylum/Class | [OEHM] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 156 |
End posion on genome | 231 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aacgtcacat |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGCGGACTCTTAATCCGTAGGTCGAGCGTTCGAGC |
Downstream region at tRNA end position |
aaataaaacc |
Secondary structure (Cloverleaf model) | >WENV181144112 Lys CTT t ACCA aaataaaacc G - C G - C G - C T - A C - G G - C T - A C G T C T C G C A T G A A | | | | | G T C T C G G A G C G C G | | | | T T G G A G C T A A AGGTC G + T C - G G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |