Sequence ID | >WENV181150449 |
Genome ID | OEHW01002707 |
Search identical group | |
Phylum/Class | [OEHW] human metagenome; G_DNA_Tongue dorsum |
Species | |
Start position on genome | 80 |
End posion on genome | 4 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ggtaatgcat |
tRNA gene sequence |
GACTCGGTAGCTCAGCTGGATAGAGCAACAGCCTTCTAAGCTGTGGGTCTAGGGTTCGAA |
Downstream region at tRNA end position |
caannnnnnn |
Secondary structure (Cloverleaf model) | >WENV181150449 Arg TCT t ACCA caannnnnnn G - C A - T C - G T + G C - G G - C G - C T A T A T C C C A C G A A | | | | | G T C T C G T A G G G C G | | | | T T G G A G C A T A A GGGTC A - T C - G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |